From the University of Ottawa: "Traditional grammar classifies words based on eight parts of speech: the verb, the noun, the pronoun, the adjective, the adverb, the preposition, the conjunction, and the interjection. Each part of speech explains not what the word is, but how the word is used. In fact, the same word can be a noun in one sentence and a verb or adjective in the next."
Often, a word first appears as a noun, and then becomes a verb. "Party" is a notable recent example. "Party on, Garth.
As a grammar geek, I am particularly fascinated by the transition of the word "street."
It started as a noun, and has worked as an adjective ("street clothes") and adverb ("he talks street"), and now functions as at least two kinds of verb:
When there's not enough evidence to hold a suspect, the precinct lieutenant or captain may tell the detectives, "We'll have to street him," meaning release him so he can go out on the street.
In retailing, the "street price" is a typical selling price for an item "on the street" -- usually lower than the suggested retail price. A sales manager might say, "The list price for our new KZR-202L is 799.95, but it will probably street for $699."
In video games, music and movies, the "street date" is the date when a new release is allowed to be sold "on the street." The sales manager might say, "The street date for the 3D Blu-Ray is December 10."
(photos from Google Images [photographer unknown], NBC, Disney)
...
Michael N. Marcus discusses writing, editing, publishing and sometimes other things. He often draws attention to inept publishers and writers. It's his duty and his compulsion. It's important and often funny. If you present work to the public, you must be able to withstand criticism. If your feelings get hurt easily, keep your work private. When you seek praise, you risk derision. In publishing, either produce pro-quality work by yourself or get help from qualified professionals.
Monday, October 31, 2011
Friday, October 28, 2011
What do you get for $195, or for nothing?
Self-publishing companies sell their services in packages priced from under $200 to over $50,000. A few companies even advertise FREE publishing. It’s very important to know what you need, what you’ll get, and what you won’t get.
Can you really get a book published for less than $200, or for free? Yes—and no.
The $199 Emerald publishing package from Outskirts Press actually provides what looks like a “real” book. The package is notable not for what it includes, but for what it excludes.
Most notable is the lack of an ISBN, which means that the book won’t be sold by booksellers. An Emerald book is not even available on the Outskirts online bookstore.
For $199 you are limited to one book size (5.5 by 8.5 inches) and a choice of two cover designs. You get exactly one book which you can read, give away, sell or display on your mantelpiece. You can order more books if you want to. They won’t be pretty, but they are books.
The top package from Outskirts costs $1099. Some other publishers may charge over $50,000. Be careful. A big investment won’t guarantee a great book, and may kill any chance of making a profit. Be sure of your goals and your budget, and act accordingly.
Strangely named Aachanon Publishing beats the $199 Outskirts Emerald deal by $4, and provides THREE “free” books—not just one. With its Budget package, you are limited to a maximum of ten black and white illustrations or photos in the text, the book size is 5 by 8 inches (a bit smaller than the Outskirts competitor), and you can have up to 300 pages. The color cover is preformatted and can include two author-provided photos or illustrations. As with the Outskirts Emerald package, there is no ISBN. You must provide distribution—booksellers won’t sell the book.
Strangely named Wasteland Press calls itself, “the cheapest full service press on the internet.” Its Basic package matches the Aachanon $195 price but provides FIVE books in either 5.5 by 8.5-inch or 6 by 9-inch size. Maximum book length is 275 pages. There is no limit to the number of photos or illustrations. The company offers faster publishing than most competitors, and its covers are “designed from scratch and are uniquely individual.” The samples I saw are quite nice. Books are sold on Wasteland’s website, and provide a 15% royalty. That’s very low for sales on a publisher’s own website..
Any day now, some company may offer a publishing package for $179, or $99.
Some of the websites for self-publishing companies tout “free” publishing programs. What you get for free is hot air. If you want real books, you pay real money.
CreateSpace, Lulu, Wordclay, UniBook and others who advertise free publishing will not charge you to upload your book’s files. They assume you will do all of the design, editing and promotional work yourself or hire others to do it.
How can they publish a book for free?
CreateSpace (which I sometimes use for printing and distribution) is an Amazon subsidiary that lets you “Self-Publish a Book-Free.” The only free things I saw on its website are “free tools to prepare your content for publication” and an ISBN that identifies CreateSpace (not you) as the publisher.
The company has two low-cost publishing programs. The standard program is sort of free. The $39 Pro program can provide so much more profit per book that you’d have to be an idiot or a pessimist not to go for the Pro.
With the “free” standard plan, apparently you don’t have to pay a penny to upload your book’s files into the CreateSpace computer and make it available for printing when orders are received. HOWEVER, each time a book is printed, you do pay a fee, and you have to order at least one book.
If you want CreateSpace to do more of the work in designing, producing, promoting and distributing your books, you can pay up to $4,999 for a publishing package.
Lulu says it is “the only publisher that offers you all that it does for free.” The company has run online ads touting “Publish Your Book—Free,” “Free publishing,” and “Free Self Publishing.” Its website promises, “free book publishing,” but the publishing is free only if you don’t want any books to be printed!
A 250-pager with decent paper will cost $9.50 in quantities up to 24. Shipping is additional. That doesn’t seem like free.
If you want Lulu to do more of the work in producing, promoting and distributing your books, and to send you a batch of books, you can pay up to $4,499 for a package.
Wordclay says, “You can sign up and start publishing your book for free. There is no cost to register with our Web site and create your account. There is no cost to use our publishing wizard to turn your work into a published book . . . . We have additional goods and services that you can also purchase through our Services Store, but again, there is no obligation. The basic publishing experience of getting your manuscript into a finished book is entirely free.” Here, too, the “free” publishing doesn’t actually include printing any books.
UniBook advertises “Free Self Publishing.” It says, “Getting your book self-published is easy. All you need to do is take a few minutes to upload your files and choose your publishing options—that’s it. Your book is instantly available for purchase worldwide in the UniBook online bookstore.” UniBook apparently has no mechanism for getting your books into stores or online booksellers. On a 300-page paperback selling for $18.95 you’ll get a royalty of about three bucks, which must be paid to you through PayPal.
...
Can you really get a book published for less than $200, or for free? Yes—and no.
The $199 Emerald publishing package from Outskirts Press actually provides what looks like a “real” book. The package is notable not for what it includes, but for what it excludes.
Most notable is the lack of an ISBN, which means that the book won’t be sold by booksellers. An Emerald book is not even available on the Outskirts online bookstore.
For $199 you are limited to one book size (5.5 by 8.5 inches) and a choice of two cover designs. You get exactly one book which you can read, give away, sell or display on your mantelpiece. You can order more books if you want to. They won’t be pretty, but they are books.
The top package from Outskirts costs $1099. Some other publishers may charge over $50,000. Be careful. A big investment won’t guarantee a great book, and may kill any chance of making a profit. Be sure of your goals and your budget, and act accordingly.
Strangely named Aachanon Publishing beats the $199 Outskirts Emerald deal by $4, and provides THREE “free” books—not just one. With its Budget package, you are limited to a maximum of ten black and white illustrations or photos in the text, the book size is 5 by 8 inches (a bit smaller than the Outskirts competitor), and you can have up to 300 pages. The color cover is preformatted and can include two author-provided photos or illustrations. As with the Outskirts Emerald package, there is no ISBN. You must provide distribution—booksellers won’t sell the book.
Strangely named Wasteland Press calls itself, “the cheapest full service press on the internet.” Its Basic package matches the Aachanon $195 price but provides FIVE books in either 5.5 by 8.5-inch or 6 by 9-inch size. Maximum book length is 275 pages. There is no limit to the number of photos or illustrations. The company offers faster publishing than most competitors, and its covers are “designed from scratch and are uniquely individual.” The samples I saw are quite nice. Books are sold on Wasteland’s website, and provide a 15% royalty. That’s very low for sales on a publisher’s own website..
Any day now, some company may offer a publishing package for $179, or $99.
CreateSpace, Lulu, Wordclay, UniBook and others who advertise free publishing will not charge you to upload your book’s files. They assume you will do all of the design, editing and promotional work yourself or hire others to do it.
How can they publish a book for free?
- They can’t. They’re lying.
CreateSpace (which I sometimes use for printing and distribution) is an Amazon subsidiary that lets you “Self-Publish a Book-Free.” The only free things I saw on its website are “free tools to prepare your content for publication” and an ISBN that identifies CreateSpace (not you) as the publisher.
The company has two low-cost publishing programs. The standard program is sort of free. The $39 Pro program can provide so much more profit per book that you’d have to be an idiot or a pessimist not to go for the Pro.
With the “free” standard plan, apparently you don’t have to pay a penny to upload your book’s files into the CreateSpace computer and make it available for printing when orders are received. HOWEVER, each time a book is printed, you do pay a fee, and you have to order at least one book.
If you want CreateSpace to do more of the work in designing, producing, promoting and distributing your books, you can pay up to $4,999 for a publishing package.
Lulu says it is “the only publisher that offers you all that it does for free.” The company has run online ads touting “Publish Your Book—Free,” “Free publishing,” and “Free Self Publishing.” Its website promises, “free book publishing,” but the publishing is free only if you don’t want any books to be printed!
A 250-pager with decent paper will cost $9.50 in quantities up to 24. Shipping is additional. That doesn’t seem like free.
If you want Lulu to do more of the work in producing, promoting and distributing your books, and to send you a batch of books, you can pay up to $4,499 for a package.
Wordclay says, “You can sign up and start publishing your book for free. There is no cost to register with our Web site and create your account. There is no cost to use our publishing wizard to turn your work into a published book . . . . We have additional goods and services that you can also purchase through our Services Store, but again, there is no obligation. The basic publishing experience of getting your manuscript into a finished book is entirely free.” Here, too, the “free” publishing doesn’t actually include printing any books.
UniBook advertises “Free Self Publishing.” It says, “Getting your book self-published is easy. All you need to do is take a few minutes to upload your files and choose your publishing options—that’s it. Your book is instantly available for purchase worldwide in the UniBook online bookstore.” UniBook apparently has no mechanism for getting your books into stores or online booksellers. On a 300-page paperback selling for $18.95 you’ll get a royalty of about three bucks, which must be paid to you through PayPal.
...
Thursday, October 27, 2011
The silly little secrets of self-publishing companies
Secret #1: Most use the same printing company
A publishing company is not a printing company. A printing company is not a publishing company. Most modern book publishers do not own printing presses. The vast majority of books published by self-publishing companies are not printed by those publishing companies. Most of their books are pro-duced and shipped by Lightning Source. It prints over a million books each month—often one at a time.
Self-publishing companies want you to think they are unique and special. Some may have better designers and editors than others, but there is no reason to believe that books published by Outskirts Press or Schiel & Denver or iUniverse will vary in physical quality. Their books may pop out of the same printing press seconds apart, along with books published by Random House, CreateSpace and my own little company.
Some companies lie about having their own printing facilities. Schiel & Denver says, “We ship worldwide from our USA printing facilities based in TN, PA and ME” and “Our book publishing company operates printing and distribution centers in the following locations . . . .” Two of the locations the company lists are cities where Lightning Source prints books.
Infinity Publishing brags that it has its own printing presses but sometimes uses Lightning Source, Infinity says, “. . . its books are not as high quality as ours . . . .” That’s a lie.
Secret #2: Some apparent competitors are owned by the same parent company
In the old days of Detroit, the car companies engaged in what was called “badge engineering.” There was often no difference under the hood of a Dodge and a Chrysler, or a Buick and an Oldsmobile, or a Ford and a Mercury. The main differences were in the headlights, grill, interior trim, tail lights, brand name, marketing pitch and price.
Similarly, bedding manufacturers make slight variations for competing retailers to make it hard for people to comparison shop at Macy’s and Sleepy’s.
In electronics, Panasonic and Quasar cordless phones came out of the same factory, but had different colors and model numbers and were sold by competing dealers.
Badge engineering now exists in the book publishing business. Author Solutions, Inc. (ASI) owns former competitors AuthorHouse, iUniverse, Trafford, Wordclay and Xlibris; and started a Spanish-language division called Palibrio. ASI also operates the self-publishing businesses for traditional publishers Harlequin, Thomas Nelson and Hay House, and for Writer’s Digest magazine.
There is little or no difference between the books pro-duced by these different brand names. Some are aimed at specific genres (such as chick-lit or Christian) while others will take money from just about anyone. An ASI editor, marketing person or cover designer may work on projects that will bear the brand names of multiple companies.
Each brand offers multiple “publishing packages.” The packages have different names, but there is little real differ-ence, and little reason to choose, for example, iUniverse over Xlibris or Hay House’s Balboa Press.
Xlibris packages are priced from $399 to $13,999, Dellarte (Harlequin) packages range from $599 to $1599, iUniverse from $599 to $4200 and Trafford from $799 to $7199. Although these price ranges are different, what you get at each price point is very close, with little or no difference in value.
I examined three different $999 publishing packages offered by different Author Solutions brands. Some have definite advantages to some authors. Other differences will be meaningless. All three include copyright registration, but only Westbow includes a Library of Congress Control Number registration. Balboa and DellArte charge $90 for it. You can get one for FREE, with a few minutes’ work.
Read carefully. What they offer may not be what they seem to offer. For example, DO NOT be falsely impressed by the inclusion of an “editorial review.” It’s not the same thing as real editing, and may lead to a sales pitch for expensive editing.
Dellarte says, “The Editorial Review is not a full manuscript edit, nor is it a replacement for the Dellarte Press full range of editorial services.”
A publishing company is not a printing company. A printing company is not a publishing company. Most modern book publishers do not own printing presses. The vast majority of books published by self-publishing companies are not printed by those publishing companies. Most of their books are pro-duced and shipped by Lightning Source. It prints over a million books each month—often one at a time.
Self-publishing companies want you to think they are unique and special. Some may have better designers and editors than others, but there is no reason to believe that books published by Outskirts Press or Schiel & Denver or iUniverse will vary in physical quality. Their books may pop out of the same printing press seconds apart, along with books published by Random House, CreateSpace and my own little company.
Some companies lie about having their own printing facilities. Schiel & Denver says, “We ship worldwide from our USA printing facilities based in TN, PA and ME” and “Our book publishing company operates printing and distribution centers in the following locations . . . .” Two of the locations the company lists are cities where Lightning Source prints books.
Infinity Publishing brags that it has its own printing presses but sometimes uses Lightning Source, Infinity says, “. . . its books are not as high quality as ours . . . .” That’s a lie.
Secret #2: Some apparent competitors are owned by the same parent company
In the old days of Detroit, the car companies engaged in what was called “badge engineering.” There was often no difference under the hood of a Dodge and a Chrysler, or a Buick and an Oldsmobile, or a Ford and a Mercury. The main differences were in the headlights, grill, interior trim, tail lights, brand name, marketing pitch and price.
Similarly, bedding manufacturers make slight variations for competing retailers to make it hard for people to comparison shop at Macy’s and Sleepy’s.
In electronics, Panasonic and Quasar cordless phones came out of the same factory, but had different colors and model numbers and were sold by competing dealers.
Badge engineering now exists in the book publishing business. Author Solutions, Inc. (ASI) owns former competitors AuthorHouse, iUniverse, Trafford, Wordclay and Xlibris; and started a Spanish-language division called Palibrio. ASI also operates the self-publishing businesses for traditional publishers Harlequin, Thomas Nelson and Hay House, and for Writer’s Digest magazine.
There is little or no difference between the books pro-duced by these different brand names. Some are aimed at specific genres (such as chick-lit or Christian) while others will take money from just about anyone. An ASI editor, marketing person or cover designer may work on projects that will bear the brand names of multiple companies.
Each brand offers multiple “publishing packages.” The packages have different names, but there is little real differ-ence, and little reason to choose, for example, iUniverse over Xlibris or Hay House’s Balboa Press.
Xlibris packages are priced from $399 to $13,999, Dellarte (Harlequin) packages range from $599 to $1599, iUniverse from $599 to $4200 and Trafford from $799 to $7199. Although these price ranges are different, what you get at each price point is very close, with little or no difference in value.
I examined three different $999 publishing packages offered by different Author Solutions brands. Some have definite advantages to some authors. Other differences will be meaningless. All three include copyright registration, but only Westbow includes a Library of Congress Control Number registration. Balboa and DellArte charge $90 for it. You can get one for FREE, with a few minutes’ work.
Read carefully. What they offer may not be what they seem to offer. For example, DO NOT be falsely impressed by the inclusion of an “editorial review.” It’s not the same thing as real editing, and may lead to a sales pitch for expensive editing.
Dellarte says, “The Editorial Review is not a full manuscript edit, nor is it a replacement for the Dellarte Press full range of editorial services.”
- Be aware that the self-publishing field is very competitive. As with cars and travel, there are abundant deals, discounts and free add-ons and upgrades. When you are offered a price, don’t be afraid to ask for a better deal, an upgrade or some freebies. Some items that may have significant value to you, have little or no cost to the publisher. Don't be afraid to ask for extra bookmarks or posters (if you think they have value), or for the September Special in November.
Wednesday, October 26, 2011
Why self-publish?
Back in the “gilded age” of the late 19th century, self-publishing was a leisure activity for rich businessmen and politicians. These men produced expensive, leather-bound, gilt-edged books for their own homes, to give to family and friends, and to donate to libraries.
Edith Wharton and other women self-published because most publishers favored men. In 1921, she became the first woman to win the Pulitzer Prize for literature. That was four years after the first man won the prize.
Mark Twain is said to have become his own publisher because he thought another publisher had cheated him.
Because of sexual content and “dirty words,” British publishers refused to print D. H. Lawrence’s Lady Chatterley’s Lover. Lawrence arranged to have it printed in Italy in 1928 (allegedly, the print shop employees couldn’t read English).
“Chatterley” was judged to be obscene in Japan in 1957 and in India in 1964. Copies were confiscated by the U.S. Post Office until the publisher won an obscenity trial in 1959. The book wasn’t openly published in Britain until 1960.
You can get a copy of an ordinary paperback “Chatterley” for less than a buck, but copies of the original self-published book were offered for sale at over $30,000—not bad for a do-it-yourself book.
Walt Whitman’s self-published Leaves of Grass is one of the most important collections of early American poetry. In 1855, it was printed in a Brooklyn print shop where Whitman did some typesetting himself—perhaps because he wanted more control than other publishers would have permitted him. A copy of this edition was on the market for $175,000—not bad for a do-it-yourself book.
In the early 21st century, as it becomes harder to make a deal with a traditional publisher, thousands of writers are taking advantage of economical printing processes and publicity opportunities to publish their own work.
I’ve had deals with three traditional book publishers.
- One cheated me.
- One tried to cheat me.
- One didn’t cheat me, but the book that finally came out was so unlike what I had expected it to be, I was sorry I got involved. I also didn’t make much money and had to wait a long time for the little money that I did get.
- The publisher that did cheat me did such a bad job on the book, and it was so unlike the vision I had for it, that I refused to let my name be printed on it.
More control: The author determines the title, cover design, page size, number of pages, price, marketing plan, publication date—everything. You even get to write the “about the author” section and choose the promotional blurbs (endorsements) that go on the cover. You are the boss and can’t be fired. There is a downside to all of this control, however. If your book is ugly or filled with mistakes, you have no one to blame but yourself! Even if you hire people to help, you are the ultimate designer, editor, fact-checker and proofreader.
Personal attention: At a big publishing house, a new book from an unknown author may get little or no attention from a sales force which is responsible for dozens or hundreds of books. A self-publishing author can concentrate on one book. She can work as hard as she wants to in promoting the book to the public, booksellers, the media and book reviewers.
Complete freedom: Self-publishing allows authors to write about anything, without needing approval from anyone. (Self-publishing companies may refuse to publish books they consider obscene or libelous.) There’s also freedom to ignore publishing traditions if the author wants to try something new.
Fun: Many people who could afford to pay for an oil change like to work on their own cars. Many people who could buy beer or wine or pizza like to experiment with their own special recipes. Lots of people who can buy food like to grow vegetables or go fishing. Do-it-yourself seems to be a common human urge, and now it is possible with publishing. My first book was published by Doubleday in 1976. I’m much prouder of the books I published myself starting in 2008—and they were a lot more fun to work on.
Niche marketing: Because of personal, professional or business connections, a writer may feel she or he is better able to market books to a specific group of potential customers than a traditional publisher could reach through traditional sellers.
Speed: With conventional publishing, it can take years to find an agent and a publisher. With independent self-publishing, a book can be on sale a week after it is written. If you use a self-publishing company, it usually takes a few months.
Durability: The author determines how long a book remains on the market.
Keeping the book current: The author determines when a new edition should be published.
Regular income: With conventional “trade” publishing, royalty checks (if there are any) arrive twice a year. With self-publishing, money can come in every day, week, month, or every three or six months—depending on the sales channels.
Higher income: Book royalties from traditional publishers pay about 8% of the cover price. Self-published authors can make more money, even from books with lower prices. (You may make more money per book if you are an independent self-publisher than if you use a self-publishing company.)
Rejection: The vast majority of books submitted to traditional publishers are rejected. Major publishers are driven by “hits.” They want books that are bought in the tens of thousands, but their judgment is not perfect. Most books do not become best-sellers, and in a few months they’re sold on the buck-a-book tables. Aside from bad writing, there are other reasons why a book may be rejected—such as an unknown author, a subject’s limited appeal, a too-controversial subject, an abundance of other books on the subject or the inappropriateness of the book for a particular publisher. But a rejection doesn’t mean that a book shouldn’t be published at all.
Keeping an old book in print: At some time, the sales volume of almost every book drops to the level at which its publisher decides to discontinue it. It becomes “out-of-print.” If that has happened to a book you wrote, you may be able to negotiate a deal with the original publisher to return the rights to you so you can republish it yourself. When sales drop to the point where the first publisher kills the book, there may not be much demand for the self-published version. But even a little demand can create income for the author; and proper marketing and/or updating may be able to boost the sales.
Chance of attracting a traditional publisher: According to the New York Times, “Louise Burke, publisher of Pocket Books, said publishers now trawl for new material by looking at reader comments about self-published books sold online. Self-publishing, she said, is no longer a dirty word.” At least one book from a self-publishing company was later re-published by a mainstream publisher and got on the New York Times Bestseller List. While dreaming of writing a bestseller is a pleasant diversion, and perhaps a good motivator to write a high-quality book, it should not be your prime objective. Realistically, you probably won’t sell a lot of books and won’t make much money, so you’ll have to have other ways to define “success” and “satisfaction.”
Some of the reasons above are my reasons. I established Silver Sands Books in the fall of 2008 to publish one book. In less than a year, I published four books, started three others, and had more on my to-do list. After two years, I had published ten books and more were “in the oven.” I've now published more than twenty. I don't know how that compares with the first years of Random House or Simon & Schuster, but I think it's pretty good.
(Morgan photo from Images of American Political History)
Tuesday, October 25, 2011
Why is self-publishing so popular now?
Years ago, all writers were publishers, applying a chunk of charcoal to cave walls, a chisel to stone or a quill to parchment. In the 21st century, once again, many writers are becoming publishers.
Self-publishing has become a powerful, popular and often misleading buzzword. Self-publishing is buzzing and booming for several reasons:
Self-publishing has become a powerful, popular and often misleading buzzword. Self-publishing is buzzing and booming for several reasons:
(1) Advances in technology and falling costs have helped to remove middlemen between creative people and their audiences, and to equalize distribution. Tiny companies—even one-person companies—can have the image and impact of giant corporations.
- Musicians and singers bypass record companies by making CDs to sell at concerts and by putting recordings online for downloading by fans.
- Bloggers reach readers without needing newspapers or magazines to publish their words.
- Videographers can reach a huge audience on YouTube.
- Thousands of people, businesses and organizations publish e-zines, websites, catalogs and newsletters with little or no professional assistance.
- Politicians and business leaders can reach voters and customers with email, blogs and websites—without having to depend on reporters to interpret and distribute their news.
(2) Specialization and “micro-ization” have revolutionized many areas of commerce.
- Giant movie theaters have been divided into multiplexes which show many movies to smaller audiences.
- Department stores are disappearing as boutiques and specialty shops are opening.
- Major beer brands face increasing competition from microbreweries.
- Giant AM and FM radio stations are losing listeners to tiny Internet radio stations and satellite radio channels which “narrowcast” to a fragmented audience.
- The traditional “Big Three” TV networks are losing viewers to cable channels and webcasts.
- Many people now prefer food that’s grown or produced nearby, rather than by a distant corporate giant.
(3) Online booksellers, particularly Amazon.com, make millions of books easily and economically available to millions of readers, worldwide.
(4) Electronic ebooks are much less expensive to produce and distribute than books printed on paper.
Combine ➀ through ➃ and the early 21st century is a great time to be a self-publishing author.
...
Monday, October 24, 2011
CreateSpace's reading robot is stupid and weird
Some of my books are printed by Lightning Source and some by CreateSpace (which is owned by Amazon.com).
I previously complained in this blog that CreateSpace was extremely paranoid about potential copyright violation. The company demanded that I show proof that I had permission to use every photograph I used in one book. I’ve never encountered this, or heard of this, with other publishers or printers. This delayed publication of the book and I had to delete and substitute some images. Maybe I should feel safer now -- less likely to be sued for copyright violation -- but I wasn't worried before.
With another book, CreateSpace did not question my photos, but rejected a book simply because it mentioned the name of corporate parent Amazon.com. I complained publicly and got a quick apology. Apparently, the robot censor was hyperactive and needed to be recalibrated.
The robot seems to have been stable for the last six months or so, but had a recent relapse.
A few days ago, I submitted a minor change to the front cover of my Stories I'd Tell My Children (but maybe not until they're adults). I made absolutely no changes to the interior text.
This morning I received this ominous warning: (left-click to enlarge)
I previously complained in this blog that CreateSpace was extremely paranoid about potential copyright violation. The company demanded that I show proof that I had permission to use every photograph I used in one book. I’ve never encountered this, or heard of this, with other publishers or printers. This delayed publication of the book and I had to delete and substitute some images. Maybe I should feel safer now -- less likely to be sued for copyright violation -- but I wasn't worried before.
With another book, CreateSpace did not question my photos, but rejected a book simply because it mentioned the name of corporate parent Amazon.com. I complained publicly and got a quick apology. Apparently, the robot censor was hyperactive and needed to be recalibrated.
The robot seems to have been stable for the last six months or so, but had a recent relapse.
A few days ago, I submitted a minor change to the front cover of my Stories I'd Tell My Children (but maybe not until they're adults). I made absolutely no changes to the interior text.
This morning I received this ominous warning: (left-click to enlarge)
The robot told me "We have noticed that the interior file submitted for this title contains text referencing Amazon.com on PDF page 314. In order to move forward, please update this text to include two additional outlets where your title is available."
The warning is weird for several reasons:
- Why should a printing company assume the role of editor?
- Why should a printing company that is owned by Amazon.com want me to promote competitors of Amazon.com? (Keep in mind that the robot was previously pissed off at me because I mentioned Amazon.com. Now Robo doesn't care if I mention Amazon -- as long as I also mention at least two competitors.)
- What would happen if a book was available ONLY at Amazon.com?
- If you left-click on the image below, you'll see that the cited page does NOT mention MY book. It does mention that books written by the late Don Martin are available at Amazon.com. I am not dead. I am not Don Martin. This line of text has been in books sold by Amazon.com (printed by Lightning Source and CreateSpace, and in an ebook) going back to 2008, and Amazon never objected before. Now Amazon's CreateSpace expects me to do research so I can plug competitors of Amazon. This is STOOOPID.
I'm waiting for an explanation from CreateSpace, and, while I am waiting for Robo to be restrained, my book is unavailable and I may be losing money.
...
Friday, October 21, 2011
What does a self-publishing author have to do?
1. Have at least one book idea.
2. Unless you are using a self-publishing company such as Xlibris or Outskirts Press and are willing to have its name on your books, pick a name for your own publishing enterprise. Think of several acceptable names and do some research so you can select one that’s not already being used by another company in publishing or a related field.
3. Register the name in the local government office that registers names, often the town clerk. You will get an “assumed name” certificate, “fictitious name” certificate, or a “DBA” (Doing Business As) certificate. You may be required to advertise the business name in a local newspaper.
4. Get whatever licenses or permits that your state or municipality requires.
5. Open a business checking account under the business name.
6. Get business cards.
7. Set up a website.
8. Set up a businesslike email address, not a free Gmail or Yahoo email account.
9. Write the first book.
10. Have the book copyedited and, if necessary, get more extensive editing.
11. Have the book read by several laypeople and, if the subject is in a specialized or technical field, by one or more experts on the subject.
12. Make the suggested changes.
13. Either gather the necessary photos, graphs and illustrations or have custom artwork made.
14. Either design the interior yourself or hire a pro to do it.
15. Either design the covers and spine yourself or hire a pro to do them. (You should probably hire a pro.)
16. Show several cover alternatives to people whose judgment you respect. Strive to stimulate thought and dialog—not merely “I like it,” “I hate it,” “OK,” “wow” or “hmmm.”
17. Put your manuscript into book-like format, using either Microsoft Word or a more sophisticated program.
18. Insert the artwork in the proper positions.
19. Read, read, read, and have others read, read, read—on the screen in multiple formats and on printed papers.
20. Establish an account with Lightning Source or CreateSpace so they will print and distribute your book—or use a self-publishing service if you want to do less work and are willing to have less control and make less money.
21. Promote, promote, promote. Let lots of potential readers know that your book exists and convince them to buy. Promotion includes news releases, book reviews, comments on blogs and websites, email signatures, your own websites and blogs, social networks including Facebook and LinkedIn, distributing business cards, mailing out letters and post cards, signing autographs at bookstore sessions, and whatever else you can think of.
...
Thursday, October 20, 2011
The justification for justification
Blocks of text are said to be “justified” or "full justified" when most lines are the same length and they fill the space from left to right.
The lines of type in this blog are like most blogs and websites and a growing number of magazines and books. The type is "flush left/ragged right." "Rag-right" is much easier to produce, and people accept it.
Justified type has a more formal, polished look. Ragged is obviously less formal, but people can rightfully claim that justified type is abnormal and artificial, and ragged right is normal and natural. Text from typewriters (remember them) is normally rag-right. Some typewriters can justify, but the result is usually ugly.
Despite lots of recent changes in publishing, justified type is still the dominant format for book printing. It can look beautiful, but takes more time and money to do right. The block of text shown below is from one of my books. I won't assert that it's beautiful, but it's better than a lot of text from self-publishers -- and it's easy to produce with Microsoft Word. If I can do this, so can almost anyone.
A lot of very ugly justified type gets printed, particularly in newspapers with narrow columns (below).

The problem exists in narrow book columns, too (below). Sometimes the only way to improve the word spacing is to switch to rag-right, or make the column wider. You can also experiment with changing some words, which can take a long time, may be futile, and may not be an option.
Next is a horrid example of justified full-width text from Release Your Writing by Helen Gallagher. Helen's pages are just five inches wide, and that size leads to pages that are often uglier than the six-inch pages used for most "how-to" paperbacks. It would be better to have wider pages, or go rag-right.
There is an unfortunate trend with self-published books to use justified type, but no hyphens, which leads to really UGH-LEE word spacing.
I purchased U-Publish.com 5.0, co-authored by Dan Poynter. This book has no hyphens, and the word spacing (below) is atrocious.
Just as poor voice quality with cellphones and VoIP service has led to the acceptance of "low fidelity" phone conversations, I fear that ugly e-books will increase the quantity and acceptance of ugly p-books. E-books designed for reflowable text and user-selectable type size (not PDF e-books) can produce some terrible-looking pages (below). Kindle’s display flexibility can produce very ugly results. This is part of Treasure Island by Robert Louis Stevenson.
My first (2008) self-published Print On Demand book, I Only Flunk My Brightest Students -- stories from school and real life, is very informal. Ragged right seemed to be appropriate for the mood of the book, and it saved time.
My second POD book, Phone Systems & Phones for Small Business & Home, is more formal, more expensive and is intended to be a reference book for business people. Justified type seemed appropriate, and I was willing to invest the extra time to make it look traditional.
When I finished my tedious labor, I was so pleased with the results, that I decided to re-do the "flunk book" with justified type, while I was making other modifications and corrections.
TIP: Be careful if you are justifying a book that was already completed with ragged right type. Most lines will expand to the right margin, and sometimes words that used to fit on one page will "creep" onto another page. You may have to change the page numbering for chapter beginnings, or cut words or make illustrations smaller to get what you want.
TIP: Sometimes the spaces between words will look lousy, and you'll have to experiment with hyphenation, and sometimes switch to shorter or longer words, or add or subtract words, to make things look right.
TIP: Be very careful to check the last line in a paragraph. Sometimes even three words are spread out full-width, and they'll look very stupid. You can just select the line and re-do it as flush-left, or (in MS Word) tap the Enter key after the last word in the line.
A while ago I got flamed in a discussion about book design, by someone I'll label an ignorant and egomaniacal belligerent asshole, who insisted that pages of text that are full-justified are harder to read than text that is rag-right. He also insisted that it's proper to have two spaces -- not one space -- between sentences (an obsolete artifact of ancient typewriters).
At one point he tried to bolster his argument for the extra space between sentences by pointing out that he had typed his flames with the extra space, which made them easier to read. Despite his vast (half-vast?) experience, he did not know that web browsers ignore the extra spaces which he deliberately inserts.
He backed up his minority position by citing his alleged 30 years experience writing and editing, and spewed the customary ad-hominem attacks at those (mostly me) who tried to explain how books are normally designed in the United States.
I saw no point in continuing to argue with the flaming asshole and bailed out. With great restraint, I resisted the urge to encourage him to perform an act of self-copulation.
I found a good comment about justification by Shannon Yarbrough in 10 Things You Should Know About Self-Publishing published on The LL Book Review: "I have never, never, NEVER seen a traditionally published book that lacked right margin justification and I’m tired of self-published authors telling me that they did it that way because it’s easier to read. No, you didn’t follow the rules because you didn’t do your homework, or you don’t know how. I know that’s harsh, but it’s the truth and it’s one reason I will turn down a book for review right away."
I could not have said it better. Thanks, Shannon.
...
The lines of type in this blog are like most blogs and websites and a growing number of magazines and books. The type is "flush left/ragged right." "Rag-right" is much easier to produce, and people accept it.
Justified type has a more formal, polished look. Ragged is obviously less formal, but people can rightfully claim that justified type is abnormal and artificial, and ragged right is normal and natural. Text from typewriters (remember them) is normally rag-right. Some typewriters can justify, but the result is usually ugly.
Despite lots of recent changes in publishing, justified type is still the dominant format for book printing. It can look beautiful, but takes more time and money to do right. The block of text shown below is from one of my books. I won't assert that it's beautiful, but it's better than a lot of text from self-publishers -- and it's easy to produce with Microsoft Word. If I can do this, so can almost anyone.
A lot of very ugly justified type gets printed, particularly in newspapers with narrow columns (below).

The problem exists in narrow book columns, too (below). Sometimes the only way to improve the word spacing is to switch to rag-right, or make the column wider. You can also experiment with changing some words, which can take a long time, may be futile, and may not be an option.
Next is a horrid example of justified full-width text from Release Your Writing by Helen Gallagher. Helen's pages are just five inches wide, and that size leads to pages that are often uglier than the six-inch pages used for most "how-to" paperbacks. It would be better to have wider pages, or go rag-right.
There is an unfortunate trend with self-published books to use justified type, but no hyphens, which leads to really UGH-LEE word spacing.
I purchased U-Publish.com 5.0, co-authored by Dan Poynter. This book has no hyphens, and the word spacing (below) is atrocious.
Dan boasts that he is “the father of self-publishing,” “the leading authority on how to write, publish and promote books,” and is “on the leading edge of book publishing.” If Dan thinks crappy typography is acceptable, he’s fallen off the edge and into the abyss. I don’t claim to be the leading authority on anything, but I could have made the paragraph much nicer:
Just as poor voice quality with cellphones and VoIP service has led to the acceptance of "low fidelity" phone conversations, I fear that ugly e-books will increase the quantity and acceptance of ugly p-books. E-books designed for reflowable text and user-selectable type size (not PDF e-books) can produce some terrible-looking pages (below). Kindle’s display flexibility can produce very ugly results. This is part of Treasure Island by Robert Louis Stevenson.
My first (2008) self-published Print On Demand book, I Only Flunk My Brightest Students -- stories from school and real life, is very informal. Ragged right seemed to be appropriate for the mood of the book, and it saved time.
My second POD book, Phone Systems & Phones for Small Business & Home, is more formal, more expensive and is intended to be a reference book for business people. Justified type seemed appropriate, and I was willing to invest the extra time to make it look traditional.
When I finished my tedious labor, I was so pleased with the results, that I decided to re-do the "flunk book" with justified type, while I was making other modifications and corrections.
TIP: Be careful if you are justifying a book that was already completed with ragged right type. Most lines will expand to the right margin, and sometimes words that used to fit on one page will "creep" onto another page. You may have to change the page numbering for chapter beginnings, or cut words or make illustrations smaller to get what you want.
TIP: Sometimes the spaces between words will look lousy, and you'll have to experiment with hyphenation, and sometimes switch to shorter or longer words, or add or subtract words, to make things look right.
TIP: Be very careful to check the last line in a paragraph. Sometimes even three words are spread out full-width, and they'll look very stupid. You can just select the line and re-do it as flush-left, or (in MS Word) tap the Enter key after the last word in the line.
A while ago I got flamed in a discussion about book design, by someone I'll label an ignorant and egomaniacal belligerent asshole, who insisted that pages of text that are full-justified are harder to read than text that is rag-right. He also insisted that it's proper to have two spaces -- not one space -- between sentences (an obsolete artifact of ancient typewriters).
At one point he tried to bolster his argument for the extra space between sentences by pointing out that he had typed his flames with the extra space, which made them easier to read. Despite his vast (half-vast?) experience, he did not know that web browsers ignore the extra spaces which he deliberately inserts.
He backed up his minority position by citing his alleged 30 years experience writing and editing, and spewed the customary ad-hominem attacks at those (mostly me) who tried to explain how books are normally designed in the United States.
I saw no point in continuing to argue with the flaming asshole and bailed out. With great restraint, I resisted the urge to encourage him to perform an act of self-copulation.
I found a good comment about justification by Shannon Yarbrough in 10 Things You Should Know About Self-Publishing published on The LL Book Review: "I have never, never, NEVER seen a traditionally published book that lacked right margin justification and I’m tired of self-published authors telling me that they did it that way because it’s easier to read. No, you didn’t follow the rules because you didn’t do your homework, or you don’t know how. I know that’s harsh, but it’s the truth and it’s one reason I will turn down a book for review right away."
I could not have said it better. Thanks, Shannon.
...
Wednesday, October 19, 2011
Be a brand
My name is Michael Marcus. Michael and Marcus and Michael Marcus are very common names.
For writing, I use my middle initial N as part of my BRAND, to distinguish myself from the many thousands of other Michael Marcuses out there.
If you Google Michael Marcus, you’ll find nearly a million links, including a Wall Street trader, a makeup artist, a jazz musician, and many, many others.
Interestingly, I am on the FIRST page of the Google links for Michael Marcus, and I have three links of the first ten. Some people and businesses pay lots of money to SEARCH ENGINE OPTIMIZATION companies to achieve high Google positioning. I didn’t pay a penny for my fame.
If you Google my name with my middle initial, you’ll find about 120,000 links. Apparently there are just two of us. The other guy is a shrink. I have nine of the ten links on the first page of searches for my name.
One good way to help people to find your work is to have a distinctive name, like actors and singers. Jor-El, Superman’s Kryptonian father’s name, is unique and distinctive. So is the name of Marlon Brando, who played the part. Marlon Brando was his birth name. Marion Morrison was less fortunate. He had to change his name to become John “Duke” Wayne.
Stephen King’s name is not unique or distinctive. But, after selling perhaps 300 million books, he probably doesn’t suffer from the existence of others with the same name. (Wikipedia listed about a dozen, including a Congressman, a pedophile and five athletes.)
Sometimes just a slight change can do the job. F. Scott Fitzgerald is probably a better choice than Francis or Frankie Fitzgerald. Bill Smith might be better remembered as William Harrington Smith or Billy D. Smith. Edward Jay Epstein has written more than a dozen books, perhaps with more success than hundreds of ordinary Ed Epsteins.
When I checked, “Edward Epstein” was the #254,818-ranked full name in www.whitepages.com, with 123 occurrences. On the other hand, Juan Epstein, from Welcome Back, Kotter, is unique, with just one listed person in the United States. It may not be a real name, however. Maybe Juan’s real name is Xavier Nguyen Bacciagalupe III, or Sally Smith.
In addition to a distinctive name, visual elements can be part of your branding. My books about publishing all have a purple band (or maybe it's maroon). Last week I bought a purple Nikon and used it last Saturday when I gave a talk about self-publishing, On Saturday, I'll use it at Self-Publishing Book Expo. I don’t have any purple shirts -- yet, but last April I had my head shaved and my full beard reduced to a goatee. I want to be noticed and remembered. I'd rather be thought of as the bald author with a beard who likes purple (or maroon), than just "some guy."
I was shy and introverted as a kid, but I got over it. If you want to sell books, you can’t be shy. If you're too timid to toot your own horn, you'll have to hire someone to toot for you. You can’t be afraid to speak to strangers. Anyone can be a customer. I recently sold a book to a clerk in a pawn shop. Sometimes it seems like I am selling one book at a time. That may seem pathetic compared to Stephen King -- but it's neither pathetic nor bad business. Each person who buys your book may tell others, and they may tell others who'll tell others.
...
For writing, I use my middle initial N as part of my BRAND, to distinguish myself from the many thousands of other Michael Marcuses out there.
If you Google Michael Marcus, you’ll find nearly a million links, including a Wall Street trader, a makeup artist, a jazz musician, and many, many others.
Interestingly, I am on the FIRST page of the Google links for Michael Marcus, and I have three links of the first ten. Some people and businesses pay lots of money to SEARCH ENGINE OPTIMIZATION companies to achieve high Google positioning. I didn’t pay a penny for my fame.
If you Google my name with my middle initial, you’ll find about 120,000 links. Apparently there are just two of us. The other guy is a shrink. I have nine of the ten links on the first page of searches for my name.
- If you want to be searchable and findable so you can sell books or any product or service, it’s important that your name become a BRAND NAME so that people who have heard of you — maybe in a conversation or an interview or an article — can FIND you and PAY you for whatever you want to sell them.
One good way to help people to find your work is to have a distinctive name, like actors and singers. Jor-El, Superman’s Kryptonian father’s name, is unique and distinctive. So is the name of Marlon Brando, who played the part. Marlon Brando was his birth name. Marion Morrison was less fortunate. He had to change his name to become John “Duke” Wayne.Stephen King’s name is not unique or distinctive. But, after selling perhaps 300 million books, he probably doesn’t suffer from the existence of others with the same name. (Wikipedia listed about a dozen, including a Congressman, a pedophile and five athletes.)
What about a pen name?
It’s not unusual for a writer to use a pen name (nom de plume in French). Mark Twain is probably the most famous fake. Twain’s real name was Samuel Langhorne Clemens, but he also used Sieur Louis de Conte.There are many reasons for using a pen name:
• To make the author’s name more distinctive, more glamorous or more interesting
• To disguise the author’s gender
• To protect the author from retribution, especially if the book is an exposé
• To avoid confusion with other authors or famous people
• To hide ethnicity or alter apparent ethnicity
• To develop different personas for different genres such as fiction and nonfiction, or chick lit and sci-fi
• To have a name more appropriate to a genre (male western writer Zane Grey was born Pearl Zane Gray).
• To avoid overexposure by having too many books on sale at one time
• To avoid embarrassment, such as when a professor writes porn, or to shield the author’s family from revelations of an unconventional or illegal past
• To avoid confusion if your name is hard to spell, remember, pronounce or seems too “foreign” or “ethnic.” Author Irving Wallace was born a Wallechinsky. His daughter writes as Amy Wallace, but his son is known as David Wallechinsky. (My father's father was born a Dzmichevitsky. I prefer "Marcus.")
• To eliminate the possibility that the book could jeopardize your success in another field
Scott Lorenz, who provides marketing and PR at Westwind Communications, suggests some reasons for using your own name on your books:
• If you are not trying to hide from anyone
• To brand your name for speaking gigs or consulting
• So people you know can find your books
• To build trust and confidence with readers
• To use your real-life expertise to validate the contents of your books
If you have a bland name like “Arthur Williams” you might be more easily found and better remembered if you change to Hamburger Williams or Xavier Nguyen Bacciagalupe III.
English punk rocker Declan MacManus morphed into a more-memorable Elvis Costello.
Don Novello wrote books as Lazlo Toth, and appeared on TV as Father Guido Sarducci. Punk-rock bass player Sid Vicious was born John Ritchie. Cher was Cherilyn Sarkisian.It’s not unusual for a writer to use a pen name (nom de plume in French). Mark Twain is probably the most famous fake. Twain’s real name was Samuel Langhorne Clemens, but he also used Sieur Louis de Conte.There are many reasons for using a pen name:
• To make the author’s name more distinctive, more glamorous or more interesting
• To disguise the author’s gender
• To protect the author from retribution, especially if the book is an exposé
• To avoid confusion with other authors or famous people
• To hide ethnicity or alter apparent ethnicity
• To develop different personas for different genres such as fiction and nonfiction, or chick lit and sci-fi
• To have a name more appropriate to a genre (male western writer Zane Grey was born Pearl Zane Gray).
• To avoid overexposure by having too many books on sale at one time
• To avoid embarrassment, such as when a professor writes porn, or to shield the author’s family from revelations of an unconventional or illegal past
• To avoid confusion if your name is hard to spell, remember, pronounce or seems too “foreign” or “ethnic.” Author Irving Wallace was born a Wallechinsky. His daughter writes as Amy Wallace, but his son is known as David Wallechinsky. (My father's father was born a Dzmichevitsky. I prefer "Marcus.")
• To eliminate the possibility that the book could jeopardize your success in another field
Scott Lorenz, who provides marketing and PR at Westwind Communications, suggests some reasons for using your own name on your books:
• If you are not trying to hide from anyone
• To brand your name for speaking gigs or consulting
• So people you know can find your books
• To build trust and confidence with readers
• To use your real-life expertise to validate the contents of your books
If you have a bland name like “Arthur Williams” you might be more easily found and better remembered if you change to Hamburger Williams or Xavier Nguyen Bacciagalupe III.
English punk rocker Declan MacManus morphed into a more-memorable Elvis Costello.
Sometimes just a slight change can do the job. F. Scott Fitzgerald is probably a better choice than Francis or Frankie Fitzgerald. Bill Smith might be better remembered as William Harrington Smith or Billy D. Smith. Edward Jay Epstein has written more than a dozen books, perhaps with more success than hundreds of ordinary Ed Epsteins.
When I checked, “Edward Epstein” was the #254,818-ranked full name in www.whitepages.com, with 123 occurrences. On the other hand, Juan Epstein, from Welcome Back, Kotter, is unique, with just one listed person in the United States. It may not be a real name, however. Maybe Juan’s real name is Xavier Nguyen Bacciagalupe III, or Sally Smith.
In addition to a distinctive name, visual elements can be part of your branding. My books about publishing all have a purple band (or maybe it's maroon). Last week I bought a purple Nikon and used it last Saturday when I gave a talk about self-publishing, On Saturday, I'll use it at Self-Publishing Book Expo. I don’t have any purple shirts -- yet, but last April I had my head shaved and my full beard reduced to a goatee. I want to be noticed and remembered. I'd rather be thought of as the bald author with a beard who likes purple (or maroon), than just "some guy."
I was shy and introverted as a kid, but I got over it. If you want to sell books, you can’t be shy. If you're too timid to toot your own horn, you'll have to hire someone to toot for you. You can’t be afraid to speak to strangers. Anyone can be a customer. I recently sold a book to a clerk in a pawn shop. Sometimes it seems like I am selling one book at a time. That may seem pathetic compared to Stephen King -- but it's neither pathetic nor bad business. Each person who buys your book may tell others, and they may tell others who'll tell others.
...
Tuesday, October 18, 2011
A book review from someone who should not be reviewing books
My Stinkers! America's Worst Self-Published Books recently went on sale. So far it has received two 5-star reviews on Amazon from apparently normal people who read and appreciated the book.
Yesterday, this bit of lunacy appeared with one star:
"Hurf durf bad writing
This guy wrote a book, also self-published, to point out the poor formatting and spelling errors in other books. I think it's supposed to be a laugh riot but I didn't find it funny at all. Am I supposed to be surprised or amused that when given the tools to self-publish without an editor, people will write poorly? [An editor may improve what is published, but does not change the ability of a writer.]
What would really be great was if he wrote an investigation of the quirkier self-published stuff that's out there, to find pearls in the infinite sea of badness. I would gladly pay money for a book that pointed me the way to better things. Pointing out that most self-published books are not worth reading is obvious and not interesting to me at all."
The reviewer, identified as "Avery Morrow, Namu Tenri-O-no-Mikoto" thinks it's supposed to be a laugh riot. I never said it's a laugh riot.
He said he is not surprised that people write badly. That's not a complaint about my book.
He said that he would prefer that I wrote a different book. That's not a complaint about this book.
His comment that "Pointing out that most self-published books are not worth reading is obvious and not interesting to me at all" demonstrates at least two things:
- He's hallucinating, or at least he doesn't read very well, because I never said anything about "most self-published books." I discussed just nine of them. Also, I covered much more than spelling errors and bad formatting; and at least one of the books I discussed did have an editor.
- He's an idiot for buying the book (if he in fact really bought the book) since it obviously does not deal with what he wanted to read about. The subject and slant of the book were obvious from the title and cover, and a free online preview was provided. Avery knew what the book was about before purchasing it. It is not the author's fault if Avery bought the wrong book.
GCAGGCGGCCGAGCGGGACTGGCTGGGTCGGCTGGGCTGCTGGTGCGAGGAGCCGCGGGG
CTGTGCTCGGCGGCCAAGGGGACAGCGCGTGGGTGGCCGAGGATGCTGCGGGGCGGTAGC
TCCGGCGCCCCTAGCTGGTGACTGCTGCGCCGTGCCTCACACAGCCGAGGCGGGCTCGGC
GCACAGTCGCTGCTCCGCGCGCGCGCCCGGCGGCGCTCCAGGTGCTGACAGCGCGAGAGA
GCGCGGCCCTCAGGAGCAAGGCGAATGTATGACAACATGTCCACAATGGTGTACATAAAG
GAAGACAAGTTGGAGAAGCTTACACAGGATGAAATTATTTCTAAGACAAAGCAAGTAATT
CAGGGGCTGGAAGCTTTGAAGAATGAGCACAATTCCATTTTACAAAGTTTGCTGGAGACA
CTGAAGTGTTTGAAGAAAGATGATGAAAGTAATTTGGTGGAGGAGAAATCAAACATGATC
CGGAAGTCACTGGAGATGTTGGAGCTCGGCCTGAGTGAGGCACAGGTTATGATGGCTTTG
TCAAATCACCTGAATGCTGTGGAGTCCGAGAAGCAGAAACTGCGTGCGCAGGTTCGTCGT
CTGTGCCAGGAGAATCAGTGGCTACGGGATGAACTGGCCAACACGCAGCAGAAACTGCAG
AAGAGTGAGCAGTCTGTGGCTCAACTGGAGGAGGAGAAGAAGCATCTGGAGTTTATGAAT
CAGCTAAAAAAATATGATGACGACATTTCCCCATCCGAGGACAAAGACACTGATTCTACC
AAAGAGCCTCTGGATGACCTTTTCCCCAATGATGAAGACGACCCAGGGCAAGGAATCCAG
CAGCAGCACAGCAGTGCAGCCGCGGCTGCCCAGCAGGGCGGCTACGAGATCCCCCGCGCG
GCTGCGGACGCTCCACAACCTGGTGATCCAGTACGCCTCGCAGGGGCGCTACGAGGTAGC
TGTGCCCCTCTGCAAGCAGGCCCTGGAGGACCTGGAGAAGACTTCAGGACACGACCACCC
GGACGTGGCCACCATGCTCAACATCCTGGCCTTGGTGTACAGGGATCAGAATAAATACAA
AGATGCAGCTAACCTACTGAATGATGCCTTGGCTATTCGTGAGAAAACTTTGGGCAAAGA
TCATCCTGCGGTGGCGGCGACTTTGAATAACCTTGCAGTCCTTTATGGTAAAAGAGGGAA
GTACAAAGAAGCAGAGCCGTTGTGTAAAAGAGCTCTGGAAATCCGAGAAAAGGTTTTGGG
GAAGGATCACCCCGATGTTGCCAAGCAGTTAAATAACTTGGCCTTACTGTGCCAGAACCA
GGGCAAGTATGAAGAAGTAGAATATTATTATCAAAGAGCCCTCGAGATCTACCAGACAAA
ACTGGGACCTGATGACCCCAACGTGGCTAAGACGAAAAATAACCTGGCATCCTGCTATTT
GAAACAAGGAAAGTTCAAGCAAGCAGAAACACTGTACAAAGAGATTCTCACTCGTGCACA
TGAAAGGGAGTTTGGTTCTGTAGATGATGAAAATAAACCCATCTGGATGCATGCTGAAGA
AAGAGAAGAATGCAAAGGAAAGCAAAAGGATGGGACATCTTTTGGAGAGTATGGCGGCTG
GTACAAAGCCTGCAAAGTTGATAGTCCAACTGTTACAACCACTCTAAAAAACCTTGGGGC
ACTTTACAGACGTCAAGGCAAATTTGAAGCTGCAGAAACGTTAGAAGAAGCTGCTATGAG
GTCTCGTAAACAGGGTCTTGACAATGTTCACAAACAGAGGGTGGCAGAAGTGCTCAATGA
CCCTGAGAACATGGAGAAGCGCAGGAGCCGTGAGAGCCTCAACGTGGACGTGGTCAAGTA
CGAGAGTGGCCCTGACGGAGGGGAGGAAGTGAGTATGAGCGTAGAGTGGAACGGG... out of space already?"
Apparently, Avery is a few ants short of a picnic. He is not properly equipped to review my book, and probably should not be allowed within 50 feet of a keyboard.
...
Monday, October 17, 2011
Saturday, October 15, 2011
Biggest business blunders of self-publishing authors
1. Not assessing the marketplace before you write the book. Who are your potential readers? Who are your competitors? What are the prices of competing books? Will your book be better, more important, less expensive, have better distribution? Does anyone need your book? Will anyone want your book?
2. Not paying for professional editing and design
3. Paying too much for a self-publishing package (If you pay $5,000 or $50,000 it will be nearly impossible to earn back your cost of publishing.)
4. Paying too little for a self-publishing package (If you pay under $400, you will probably get terrible books.)
5. Not budgeting for promoting your book
6. Allowing a big “discount” for bricks-and-mortar booksellers which probably won’t stock your book anyway, and giving up the additional profit you could get from online sales
7. Assuming that your publisher or printer will do a good job of promoting your books
8. Assuming that your book will be reviewed without trying to get it reviewed
9. Not having a website and blog
10. Assuming that your work is finished when your book is finished
11. Assuming that your publishing company’s website will sell lots of books for you.
12. Pricing your book too high
13. Pricing your book too low
14. Producing your book in only one format: you should have one or two print formats, plus one or three e-book formats.
15. Waiting until the book is printed to start marketing
16. Not having an understandable title
17. Not having a distinctive title
18. Not having a subtitle that can help sell the book
...
Friday, October 14, 2011
You've read my words. Tomorrow you can hear me speak.
Tomorrow I'll be discussing "The Brave New World of Ebooks and Self-Publishing" at a one-day "intensive workshop" on writing and publishing being held at the University of Connecticut in Stamford, CT. I'm one of about 10 speakers, and anyone in the NY-CT metro area who is considering writing a book should learn a lot there. I'll be giving away some free books, too.
Unlike those books, the event is not free, but if you bring a friend, the two of you will pay the price of just one person. Lunch is included, and you'll get a goody bag, too. If you pay a bit extra, there are added benefits including front-row seating, another free book and admission to a cocktail party where you can schmooze and network while you eat and drink.
If for some reason you are not "delighted" with the event and do not feel the provided material is useful for you, simply turn in all your workshop materials before the event ends, tell the staff what you think, and you will get a check for a full 100% refund of your registration fee.
There is still time to register. Do it now.
...
Thursday, October 13, 2011
Try writing two books at one time
Many writers think they have several books "in them." Usually they are written in sequence, and trouble with one book can delay starting the next one.
As an alternative, consider working on two or more books at the same time. Lots of people read several books during the same week, changing books whenever they feel like it. There's no reason not to switch the books you're writing, too.
This way, if you you hit a writer's block and stall on one book, or simply get out of the mood, you can switch books and keep being productive.
This doesn't work all the time, but if the books are very different the change can be both relaxing and stimulating. I once simultaneously wrote a humor book and a technical book. I'm now working on several books about publishing plus a true-crime book.
Also, you may find that a concept or some actual words in Book A can be used in Book B. Or maybe even give you an idea to write Book C.
What was going to be my Book C became my Book B, but parts of B are in C, and A gave me the ideas for D and E.
And, even if you're working on just one book, you can skip around within the book. If you're having trouble with Chapter 3, work on a chapter that happens later, or go back and edit chapter 1.
...
As an alternative, consider working on two or more books at the same time. Lots of people read several books during the same week, changing books whenever they feel like it. There's no reason not to switch the books you're writing, too.
This way, if you you hit a writer's block and stall on one book, or simply get out of the mood, you can switch books and keep being productive.
This doesn't work all the time, but if the books are very different the change can be both relaxing and stimulating. I once simultaneously wrote a humor book and a technical book. I'm now working on several books about publishing plus a true-crime book.
Also, you may find that a concept or some actual words in Book A can be used in Book B. Or maybe even give you an idea to write Book C.
What was going to be my Book C became my Book B, but parts of B are in C, and A gave me the ideas for D and E.
And, even if you're working on just one book, you can skip around within the book. If you're having trouble with Chapter 3, work on a chapter that happens later, or go back and edit chapter 1.
...
Wednesday, October 12, 2011
In case you were wondering...
A geek is clumsier than a nerd, who is less single-minded than a wonk and less obsessively studious than a grind -- but the terms overlap in many respects.
Read more: http://forward.com/articles/136405/#ixzz1HXMFJoLb
Read more: http://forward.com/articles/136405/#ixzz1HXMFJoLb
Tuesday, October 11, 2011
Book about book promoting is now bigger and better
Carolyn Howard-Johnson (www.sharingwithwriters.blogspot.com) is an award-winning author and a former publicist. With a last name that makes me keep thinking about fried clam strips and ice cream, Carolyn serves up a large portion of useful info and advice. Her book, The Frugal Book Promoter: How to Do What Your Publisher Won’t was one of the first books I bought when I started self publishing in 2008, and it has been extremely useful.
It has just been updated with a new subtitle ("How to get nearly free publicity on your own or by partnering with your publisher") that recognizes self-publishing, and it has been expanded to include simple ways to promote books using newer technology. I bought the new book a few days ago and recommend it highly. It can empower you to give your book the best possible start in life.
Book promotion has changed tremendously since publication of the first "Frugal" in 2004, particularly because of the web, e-books and the growing acceptance of self-published books. So, this new edition includes lots of information on ways to promote that were not around or were in their infancy a few years ago.
Here's some of what's new: (1) The Second Edition has been reorganized. (2) It's much bigger -- so it can be much more helpful. (3) Updates on writers’ conferences, getting reviews, book fairs and trade shows; media releases, query letters and media kits; working with a professional publicist; "backdoor methods" of getting reviews -- even long after a book has been published (4) Online bookstores (5) Blogging (6) Social networks (7) Avoiding scam-traps
"Frugal" shows you how to promote your book with powerful but inexpensive or even free publicity. Carolyn points out important publicity possibilities that you may not think of, like reviewing other authors’ books.
The promotional tips are not just theory -- they come from Carolyn’s own successful book campaigns. Several ideas will certainly be right for you and your book.
Most new writers have much more time than money, and this book can help you achieve big-buck results with minimum use of your credit cards -- and no federal bailout. “Frugal” belongs on every author’s shelf, whether you are an independent self-publisher, are using a self-publishing company or a traditional publisher.
Here are some of Carolyn’s tips:
...
It has just been updated with a new subtitle ("How to get nearly free publicity on your own or by partnering with your publisher") that recognizes self-publishing, and it has been expanded to include simple ways to promote books using newer technology. I bought the new book a few days ago and recommend it highly. It can empower you to give your book the best possible start in life.
Book promotion has changed tremendously since publication of the first "Frugal" in 2004, particularly because of the web, e-books and the growing acceptance of self-published books. So, this new edition includes lots of information on ways to promote that were not around or were in their infancy a few years ago.
Here's some of what's new: (1) The Second Edition has been reorganized. (2) It's much bigger -- so it can be much more helpful. (3) Updates on writers’ conferences, getting reviews, book fairs and trade shows; media releases, query letters and media kits; working with a professional publicist; "backdoor methods" of getting reviews -- even long after a book has been published (4) Online bookstores (5) Blogging (6) Social networks (7) Avoiding scam-traps
"Frugal" shows you how to promote your book with powerful but inexpensive or even free publicity. Carolyn points out important publicity possibilities that you may not think of, like reviewing other authors’ books.
The promotional tips are not just theory -- they come from Carolyn’s own successful book campaigns. Several ideas will certainly be right for you and your book.
Most new writers have much more time than money, and this book can help you achieve big-buck results with minimum use of your credit cards -- and no federal bailout. “Frugal” belongs on every author’s shelf, whether you are an independent self-publisher, are using a self-publishing company or a traditional publisher.
Here are some of Carolyn’s tips:
- Read, read, read: Even your junk mail can be useful. My daughter found a flier from the local library in the Sunday paper stuffed between grocery coupons. It mentioned a display done by a local merchant in the library window. My book was displayed in their lobby and I became a seminar speaker for their author series. Rubbish (even spam email) can be valuable.
- Keep an open mind for promotion ideas: Look at the different themes in your book. There are angles you can exploit when you’re talking to editors. My book, This is the Place is romantic and set in Salt Lake City, the site where the winter Olympic games were played in 2002. I found sports desks and feature editors open to it as Olympics fervor grew, and even as it waned.
- Etiquette counts: Send thank-you notes to contacts after they’ve featured you or your book. This happens so rarely they are sure to be impressed and to pay attention to the next idea you have, even if it’s just a listing in a calendar for your next book signing.
- Publicize who you are, what you do: Reviews aren’t the only way to go. Think of angles for human interest stories, not only about your book but about you as its author. Are you very young? Is writing a book a new endeavor for you? Several editors have liked the idea that I wrote my first book at an age when most are thinking of retiring, that I think of myself as an example of the fact that it is never too late to follow a dream.
- Develop new activities to publicize: Don’t do just book signings. Use your imagination for a spectacular launch. Get charities involved. Think in terms of ways to help your community.
- Frequency is important: The editor who ignores your first release may pay more attention to your second or 25th. She will come to view you as a source and call you when she needs to quote an expert. This can work for novels as well as nonfiction. Publicity is like planting bulbs. It proliferates even when you aren’t trying.
...
Subscribe to:
Posts (Atom)























